Cysteine codon 1559 (TGC) in exon 31 was changed to phenylalanine (TTC) (c.4676G>T, p.C1559F) using an sgRNA (targeting TGTTGGTCGTTTCGTTCAGGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4685G>T (p.Cys1562Phe) mutation associated with craniofacial, neural, and cardiac anomalies. (J:335489)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count