Threonine codon 555 (ACC) in exon 14 was changed to alanine (GCC) (c.1663A>G, p.T555A) using a crRNA (targeting GGGTGCCACGATGCGCTGGGTGG) and an ssODN tempate with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphoblocker. (J:336786)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count