Cysteine codon 170 (TGC) was changed to alanine (GCC) (p.C170A) using an sgRNA (targeting GATTAATTTTAGTTGCAACA) and an ssODN template with CRISPR/Cas9 technology. The affected residue is located in the COMM domain of the encoded peptide, which is involved in complex formation with COMMD8. This mutation abrogates the inhibitory effect of celastrol on the COMMD3/8 complex. (J:337427)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count