This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CGGAGGCATGATGGTCAACG and ATGGTCATTGGGCAATACTC targeting from within exons ENSMUSE00000960385 to ENSMUSE00000952793. This resulted in a 1738-bp deletion of Chr15 from 75321375 to 75323112 (GRCm39) and a 40 bp insertion. (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count