This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GACAAACTAGGTTCACAGCA and CCTTCTGGAAAGCTGCTAGG, which resulted in a 430 bp deletion beginning at Chromosome 11 position 97,038,696 bp and ending after 97,039,125 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000111048 (exon 3) and 321 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 46 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count