CRISPR/Cas9 technology using the 5 gRNA TTTATGCATCCATCAAGGCT which cut 54 bp upstream of Gsdma3 exon 1 and the 3 gRNA TCGGAGTCATTCATCGGCCA which cut 156 bp downstream of Gsdma1 exon 12, deleted a region of approximately 52 kb that eliminates the coding sequence of all three genes Gsdma, Gsdma2, and Gsdma3 and includes no overlapping genes on either DNA strand. Sequencing confirmed knock-out of all three genes. (J:339428)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count