Using CRISPR/cas9 genome editing, the entire coding sequence of the forkhead box I3 (Foxi3 locus on chromosome 6) was replaced with a (from 5' to 3') CreERT2 fusion cDNA, P2A peptide sequence followed by enhanced green fluorescent protein (eGFP), a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), a polyA signal, and a PGK-neo resistance cassette. This entire construct was electroporated, with CRISPR-assisted targeting vectors (gRNA CCCCCGGGATGGCTCTGATATA), in embryonic stem (ES) cells. (J:339365)
Basic Information
Insertion, Intragenic deletion
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count