A 1 nt deletion at cDNA position 402 (c.402del) was created by targeting exon 1 with an sgRNA (targeting GTACCCCAGCCAGCACGGAC) and an ssODN template using CRISPR/Cas9 technology, resulting in a frameshift and premature stop codon (p.A136Pfs*80). Tbr1 transcript Tbr1-201 (ENSMUST00000048934.15) is used as reference for exon number and guide sequence. There is no detectable TBR1 protein expression from this allele. This frameshift mutation was identified in a patient with autism. (J:339271)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count