Dynll2^em1(IMPC)J

This allele generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATGCTGTTAGTGCCACCGGT and TGGGAGCTATAAGGTTAGCG, which resulted in a 4626 bp deletion beginning at Chromosome 11 position 87,979,468 bp and ending after 87,984,093 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000105250 and ENSMUSE00000674840 (exons 2 and 3) and 2441 bp of flanking intronic sequence including the splice acceptor, start site and donor and is predicted to result in a null allele. (J:188991)