One of coding cDNA C nucleotides at c.1145-1148 (GRCm39:chr10:g.75732893-75732896) was targeted for deletion using a crRNA (targeting GCCAACACTGCCCCAGCC) and an ssODN template (GGCGAATGAGGCGTCTTGCCAACACTGCCCAGCCTGGTGATGAAGACATCCATGCTCGAC) with CRISPR/Cas9 technology. The deletion causes a frameshift just before the stop codon, which replaces the last 3 endogenous codons with 35 non-endogenous codons. (J:337790)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count