Alanine codon 193 (GCT) in exon 7 was changed to proline (CCT) (ENSMUST00000040865:c.577G>C, p.A193P) using an sgRNA (targeting CCAATCACTGTCTGCCGCTG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with nanophthalmos. (J:337903)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count