Lysine codon 298 in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was targeted for change to alanine using an sgRNA (targeting TTGGTTGGTTCCACCAACAAAGG ) and an ssODN template with CRISPR/Cas9 technology. This allele is the result of incorrect repair, with the insertion or duplication of a C five nucleotides from the 3' end of the exon (GRCm39:chr3:108580229dup), resulting in a frameshift and a premature stop codon shortly thereafter. (J:338078)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count