Lysine codon 298 (AAG) in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was changed to alanine (GCG) (p.K298A) using an sgRNA (targeting TTGGTTGGTTCCACCAACAAAGG) and an ssODN template with CRISPR/Cas9 technology. The affected residue is evolutionary conserved and critical for the channel function of the encoded peptide. (J:338078)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count