Tryptophan codon 267 (TGG) in exon 8 (ENSMUST00000106609) or 9 (ENSMUST00000029483) was changed to arginine (CGG) (p.W267R) using an sgRNA (targeting TTGGCATGGGTCATCCTTATAGG ) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation found in amyotrophic lateral sclerosis (ALS) patients. (J:338078)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count