Serine codon 155 (TCT) in exon 1 was changed to alanine (GCT) (p.S155A) using an sgRNA (targeting GTGCTTTGACCTCCGAAGGAAGG and GACTCTGTCAGCACCTTCTCTGG) and an ssODN template with CRISPR/Cas9 technology. This mutation changes the affected residue in the encoded peptide from phosphorylatable to a phosphoblocker. (J:338167)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count