Slc25a32^em3Liliu

Tyrosine codon 174 (TAT) in exon 4 was changed to cysteine (TGT) (c.521A>G, p.Y174C) using an sgRNA (targeting TATAAATATGAAGGTGTGCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). This allele also contains an unintended c.552G>A (AAG to AAA, p.K184K) mutation in the last base of exon 4 that changes splice donor site G-GT to A-GT. This affects splicing, resulting in transcripts that skip exon 4 or exons 3 and 4. (J:338257)