Lysine codon 235 (AAA) in exon 6 was changed to arginine (AGA) (c.704A>G, p.K235R) using an sgRNA (targeting ATACGGGTATGTTGCTGCTACGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with riboflavin-responsive exercise intolerance (RREI). (J:338257)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count