Tryptophan codon 317 (TGG) in exon 10 was changed to arginine (CGT) (c.949_951delTGGinsCGT, p.W317R) using an sgRNA (targeting CATTTGATACTCTTCGACTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human c.949C>T:p.W317R mutation associated with polymicrogyria (PMG). (J:338312)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count