Leucine codon 85 (CTA) in exon 4 was changed to arginine (CGA) (c.254T>G, p.L85R) using an sgRNA (targeting CAGACTTGGTTTCTAGATGA) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with polymicrogyria (PMG). (J:338312)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count