Arginine codon 134 (CGG) in exon 4 was changed to glutamic acid (GAA) (p.R134E) using an sgRNA (targeting CACAGGCCACCTTCCCACAGCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.K131E mutation found in a patient suffering from erosive arthritis and osteomyelitis. (J:338375)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count