This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGAGACTTTGATTTAGCGC and ATTGTGATCCTGTAAACTGC, which resulted in a 439 bp deletion beginning at Chromosome 6 position 146,997,890 bp and ending after 146,998,328 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294346 (exon 9) and 324 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 232 and early truncation 17 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count