Methionine codon 143 in exon 2 was targeted for change to valine using an sgRNA (targeting TTCAATGCTTGAAGACCCTTNGG) and an ssODN template with CRISPR/Cas9 technology. Besides the intended allele (Mplkipem1Nimo), this also created this allele that has a 34 bp deletion (TGAAGACCCTTGGGCTGGCCTAGAACCAGTGTCT), which leads to a frameshift and premature stop codon. No protein is expressed from this allele. (J:338438)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count