Leucine codon 507 (CTG) in exon 15 was changed to arginine (CGG) (p.L507R) using an sgRNA (targeting CTGGTGGAGCTGCTGAATCGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.L505R variant in the nuclear export sequence (NES) of the encoded peptide, which blocks export of the protein from the nucleus. (J:338708)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count