CRISPR/cas9 genome editing used guide RNAs guides (GGTGGTCAGTGGTACTTAGT and GTGGTCAGTGGTACTTAGTG) to insert an LSL targeting vector with a loxP-flanked STOP cassette (which contains a splice acceptor and 3x SV40 polyadenylation sequence), upstream of exon 7 of the gene. Slc6a1 transcript Slc6a1-201 (ENSMUST00000032454.8) was used as reference for the exon number and guide sequences. (J:94077)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count