Calm1^em1Dmy

Lysine codons 22, 95 and 116 (AAA, AAG, AAG) were changed to arginine (AGG) (p.K22R, p.K95R, p.K116R) using sgRNAs (targeting TTCTCCCTATTCGATAAAGATGG and TTAGAACTGAGTGAGCACCAGGG) and a dsDNA donor vector with CRISPR/Cas9 technology. The donor sequence replaces exon 3 from bp 29 and the first 28 bp of intron 3 and contains the following: 35 bp left homology arm (last 7 bp intron 2 + first 28 bp exon 3), 387 bp coding sequence for AA 22-149 + TGA stop codon with the three lysine-to-arginine mutations and alternative codons for most or all of the codons for the non-mutated amino-acids, bovine growth hormone gene poly(A) signal sequences, and 35 bp right homology arm (intron 3 from bp 29). The mutations block the affected residues in the encoded peptide from being acetylated. (J:338763)