CRISPR/cas9 genome editing used a guide crRNA [CGACCTGAGAATGTTGGTGC] to insert an internal ribosomal entry site (IRES)/mCherry red fluorescent /3XFLAG epitope fusion gene into the 3' UTR of the gene. Tcf transcript Tcf-201 (ENSMUST00000086844.10) was used as reference for the exon number and guide sequences. (J:307783)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count