Threonine codon 277 (ACA) and serine codons 278 (AGC) and 279 (TCA) were changed to alanine (GCTGCAGCC) using an sgRNA (targeting ACAAGCTCAAAAAACCGAAATGG) and an ssODN template with CRISPR/Cas9 technology. The mutation changes three phosphorylatable residues in the cytoplasmic tail of the encoded peptide to phosphoblockers, disrupting chemokine signaling in dendritic cells. (J:304322)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count