Ccnd3^em1Prad

Threonine codon 283 (ACT) in exon 7 was changed to alanine (GCT) (p.T283A) using an sgRNA (targeting GCTAGAGCCCCGGGGGGCTT) and an ssODN template with CRISPR/Cas9 technology. The mutation in the PEST domain of the encoded peptide, the equivalent of the human mutation associated with B cell non-Hodgkin lymphoma (B-NHL), replaces a phosphorylatable residue with a phosphoblocker and hyper-stabilizes the peptide. (J:304765)