Dhrs7^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCTCATCCTTACATCCCCA and TCTACCCCACAAAAAGGTGG, which resulted in a 1560 bp deletion beginning at Chromosome 12 position 72,656,058 bp and ending after 72,657,617 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000299539 and ENSMUSE00000114560 (exons 3 and 4) and 1213 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 95 and early truncation 7 amino acids later. (J:188991)