Proline codons 185 (CCT) and 186 (CCC) in exon 5 were changed to alanine (GCC and GCA) (p.P185_P186delinsAA) using an sgRNA (targeting ACTCCTGATGGATGCGCTTA) and an ssODN template with CRISPR/Cas9 technology. This mutation causes the encoded peptide to lose its RNA-binding activity. (J:314427)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count