Phenylalanine codon 187 (TTT) in exon 5 was changed to glycine (GGC) (p.F187G) using an sgRNA (targeting ACTCCTGATGGATGCGCTTA) and an ssODN template with CRISPR/Cas9 technology. This mutation renders the encoded peptide catalytic-dead, losing its RNA methylation activity. (J:314427)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count