This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGCAAATGTGACATAAGCG and GATGGTTTACAGGTTAGCAG, which resulted in a 2961 bp deletion beginning at Chromosome 8 position 123,255,684 bp and ending after 123,258,644 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001238666, ENSMUSE00001307651, ENSMUSE00001236036, ENSMUSE00000215264 and ENSMUSE00001232446 (exons 2-6) and 2000 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 60 amino acids later. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count