This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ACTCCTCCCTGTGGTCAATA targeting the 5' side and AGGGGTTATTCACAACATGC targeting the 3' side of a critical region (ENSMUSE00001163295). This resulted in a 959-bp deletion of Chr1 from 16148033 to 16148991 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count