Arginine codon 261 (CGA) in exon 7 was changed to glutamine (CAA) (c.782 G>A, p.R261Q) using an sgRNA (targeting AGTGGAAGACTCGGAAGGCCAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with phenylketonuria (PKU). (J:305268)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count