Arginine codon 1170 (CGG) in exon 25 was changed to tryptophan (TGG) (c.3508C>T, p.R1170W) using an sgRNA (targeting CCCCGGGCCATTGTATTATACCAT) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics a human mutation associated with a sclerosteosislike phenotype. (J:305286)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count