Aspartic acid codon 204 (GAC) in exon 7 was changed to histidine (CAC) (p.D204H) using an sgRNA (targeting GTTCATTATTGACACTTGCC) and an ssODN template with CRISPR/Cas9 technology. The mutation mimics the same human mutation associated with severe infantile encephalopathy. (J:305399)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count