A single nucleotide (T) insertion into exon 1 was created using an sgRNA (targeting TCTCTCGGCAGCTCTGCCGC) and an ssODN template with CRISPR/Cas9 technology, resulting in a reading frame shift and premature stop codon (c.87_88insT, p.I30Yfs*10). The mutation mimics the same human mutation associated with severe infantile encephalopathy. (J:305399)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count