Isoleucine codon 125 (ATT) in exon 1 was changed to leucine (CTT) (p.I251L) using an sgRNA (GACUCCAAUCAGGAUGGUCA) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human variant associated with protection against obesity and increased adiposity in people of European descent. (J:305517)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count