Arginine codon 164 (CGT) in exon 2 was changed to histidine (CAC) (p.R164H) using an sgRNA (targeting TGCCCAGGCTGCAGCAGACA) and an ssODN template with CRISPR/Cas9 technology. This mutation in the fifth TRP motif inhibits Rapsn LLPS (liquid-liquid phase separation). (J:307397)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count