Tgoln1^em1(IMPC)J

This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCTTACCACAACAAACGAA and GCGTCTCTCTTATAAACGGA, which resulted in a 916 bp deletion beginning at Chromosome 6 position 72,615,524 bp and ending after 72,616,439 bp (GRCm38/mm10). This mutation deletes 916 bp from ENSMUSE00000431829 (exon 2) and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 24 amino acids later. (J:188991)