This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTGGTTCCACATTATCAGA and GGACGTCTTGAAATCTGGGC, which resulted in a 3242 bp deletion beginning at Chromosome 16 position 29,217,529 bp and ending after 29,220,770 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001294575 and ENSMUSE00000266795 (exons 2 and 3) and 2837 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to generate a null allele. (J:188991)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count