Aspartic acid codon 288 (GAC) in exon 6 was changed to glycine (GGC) (p.D288G) using sgRNAs (targeting ACCAATACAAGTGTAATGGTG and ACATATGTGTGATGTGCACG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.D283G mutation associated with C3 glomerulonephritis (C3GN). (J:308307)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count