Arginine codon 83 (CGC) in exon 2 was changed to cysteine (TGC) (p.R83C) using an sgRNA (targeting GTTTGGACAACGCCCGTATTG) and an ssODN template with CRISPR/Cas9 technology. This mutation mimics the same human mutation found in glycogen storage disease type Ia (GSD-Ia) patients. (J:320697)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count