CRISPR/cas9 endonuclease-mediated genome editing uses two guide RNAs [GTGCTGGGTGTTTGCAGCGGTGG and AGTGAAGTACGGGCAGTGCTGGG] to insert the cysteine to serine amino acid substitution in at residue 277 (exon 6). Tgm2 transcript Tgm2-201 was used as reference for the exon numbers and guide sequence (ENSMUSG00000037820). (J:337709)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count