CRISPR/cas9 gene editing uses two guide RNAs to insert loxP sites around the promoter and full coding sequence. The 5'sgRNA (GGACAACGTGGGCAAAACTG) is designed to target chromosome 6 (Chr 6) coordinates 86,526,355 to 86,526,374 (Mus musculus genomic assembly mm10), and the 3'sgRNA (AGCACCCCATACTTAAAACA) targeted to Chr 6, positions 86,524,407 to 86,524,426. (J:337554)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count