CRISPR/cas9 genome editing is used to delete exon 6. The intron 5 sgRNA (Runx1E6_gRNA.254, GGGCACCGAGTCCCAGACTG) was designed to target chromosome 16 (Chr 16) coordinates 92644590 to 92644609 (Mus musculus genomic assembly mm10) and the intron 6 sgRNA (Runx1E6_gRNA.121, GAAACCCCGCAGCATCAGCT) targeted to Chr 16, positions 92644031 to 92644050. (J:265272)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count