This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACTGAGAACGACATGAG targeting the 5' side and ACAATTACAGCTACCTGCGC targeting the 3' side of a critical region (ENSMUSE102410139). This resulted in a 1393-bp deletion of ChrX from 102408747 to 102410139 with the insertion of 102410139 (GRCm39), introducing a frameshift and premature stop codon. (J:265051)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count