Valine codon 79 (GTT) in exon 3 was changed to leucine (CTT) (NM_172015.3:c.235G>C, p.V79L) using a crRNA (targeting TGTCAACGTGAAACCCGCTC) and an ssODN template with CRISPR/Cas9 technology. The mutation is associated with weak calf syndrome in cattle. (J:104881, J:340986)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count