Glycine codon 125 (GGC) was changed to arginine (CGC) (p.G125R) using sgRNAs (targeting TAGGCCTTCATGTAGGTCCGTAAC and AAACGTTACGGACCTACATGAAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with HoltOram syndrome (HOS) or handheart syndrome. (J:333401)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count