A single nucleotide (A) was inserted (after GRCm39:g.80264764A) into exon 6 using an sgRNAs (targeting GGATTAATGAGGAAATAGAG) and an ssODN template with CRISPR/Cas9 technology. This frameshift mutation was generated next to the site of the human p.E246* mutation associated with autism spectrum disorder (ASD). (J:332937)
Legend:
cx: complex: > 1 genome feature ot: other: hemizygous, indeterminate,... (F): Female
(M): Male
N: normal phenotype
(#): related diseases count